Review



anti clic3 antibody  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 91
      Buy from Supplier

    Structured Review

    Santa Cruz Biotechnology anti clic3 antibody
    Anti Clic3 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti clic3 antibody/product/Santa Cruz Biotechnology
    Average 91 stars, based on 3 article reviews
    anti clic3 antibody - by Bioz Stars, 2026-06
    91/100 stars

    Images



    Similar Products

    gene exp clic3 hs00362166 g1  (Thermo Fisher)
    94
    Thermo Fisher gene exp clic3 hs00362166 g1
    Gene Exp Clic3 Hs00362166 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp clic3 hs00362166 g1/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    gene exp clic3 hs00362166 g1 - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier
    anti clic3 antibody  (Santa Cruz Biotechnology)
    91
    Santa Cruz Biotechnology anti clic3 antibody
    Anti Clic3 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti clic3 antibody/product/Santa Cruz Biotechnology
    Average 91 stars, based on 1 article reviews
    anti clic3 antibody - by Bioz Stars, 2026-06
    91/100 stars
    		  Buy from Supplier
    anti clic3 antibody  (Proteintech)
    93
    Proteintech anti clic3 antibody
    Anti Clic3 Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti clic3 antibody/product/Proteintech
    Average 93 stars, based on 1 article reviews
    anti clic3 antibody - by Bioz Stars, 2026-06
    93/100 stars
    		  Buy from Supplier
    clic3  (Santa Cruz Biotechnology)
    94
    Santa Cruz Biotechnology clic3
    Clic3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/clic3/product/Santa Cruz Biotechnology
    Average 94 stars, based on 1 article reviews
    clic3 - by Bioz Stars, 2026-06
    94/100 stars
    		  Buy from Supplier
    anti clic3  (Cell Signaling Technology Inc)
    86
    Cell Signaling Technology Inc anti clic3
    Anti Clic3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti clic3/product/Cell Signaling Technology Inc
    Average 86 stars, based on 1 article reviews
    anti clic3 - by Bioz Stars, 2026-06
    86/100 stars
    		  Buy from Supplier
    cactcggtgatgaggctgat primer clic3 sangon biotech f  (Sangon Biotech)
    86
    Sangon Biotech cactcggtgatgaggctgat primer clic3 sangon biotech f
    Cactcggtgatgaggctgat Primer Clic3 Sangon Biotech F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cactcggtgatgaggctgat primer clic3 sangon biotech f/product/Sangon Biotech
    Average 86 stars, based on 1 article reviews
    cactcggtgatgaggctgat primer clic3 sangon biotech f - by Bioz Stars, 2026-06
    86/100 stars
    		  Buy from Supplier
    sirnas against clic3  (Sangon Biotech)
    90
    Sangon Biotech sirnas against clic3
    Sirnas Against Clic3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirnas against clic3/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    sirnas against clic3 - by Bioz Stars, 2026-06
    90/100 stars
    		  Buy from Supplier
    anti clic3  (Proteintech)
    93
    Proteintech anti clic3
    Anti Clic3, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti clic3/product/Proteintech
    Average 93 stars, based on 1 article reviews
    anti clic3 - by Bioz Stars, 2026-06
    93/100 stars
    		  Buy from Supplier

    Image Search Results